Basic Information


ANNInter ID ANNInter76286
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005092 ath_circ_046348
Category tsRNA circRNA
Coordinate Mt:10766-361181(.)
Interaction Sequence GGAUUAAGGCAGUGGAUUGUGAA UUCACAAUCCACUGCCUUGAUCC
Interaction Site 1 - 23 348936 - 348958

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network