Basic Information


ANNInter ID ANNInter75917
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr005037 URS0002398362_3702
Category tsRNA lncRNA
Coordinate 3:4917585-4925296(+)
Interaction Sequence GGAUACUCGGCUCUCACCCG CGGGUGGGGACCGAGGAUUU
Interaction Site 1 - 20 1645 - 1664

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network