Basic Information
| ANNInter ID | ANNInter75708 | 
|---|---|
| Interaction Type | tsRNA - circRNA | 
| Identification Method(s) | psRNATarget | 
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 | 
|---|---|---|
| ncRNA ID | ath_tsr004909 | ath_circ_047846 | 
| Category | tsRNA | circRNA | 
| Coordinate | Pt:1312-137153(.) | |
| Interaction Sequence | GCUGUAGUUUAGUGGUUAGAAUUCC | GGAGCUCUACCAACUGAGCUAUAUC | 
| Interaction Site | 1 - 25 | 133646 - 133670 |