Basic Information
| ANNInter ID | ANNInter75696 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr004908 | ath_circ_030242 |
| Category | tsRNA | circRNA |
| Coordinate | 4:6527907-6542833(.) | |
| Interaction Sequence | GCUGUAGUUUAGUGGUUAGAAUCCC | CUGAUUGUAACCACUAAACUGUGGA |
| Interaction Site | 1 - 25 | 13263 - 13287 |