Basic Information
| ANNInter ID |
ANNInter75267 |
| Interaction Type |
tsRNA - lncRNA |
| Identification Method(s) |
RNAhybrid;IntaRNA |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath_tsr004800 |
URS00023C5774_3702 |
| Category |
tsRNA |
lncRNA |
| Coordinate |
|
5:22247156-22247505(+) |
| Interaction Sequence |
UCGAAUCCCAGCAGCCACACC |
GCUGUGGCUGCUGAGGAUUUGA |
| Interaction Site |
3 - 23 |
151 - 172 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
NA |
| RNAhybrid MFE |
-38.8 |
| IntaRNA MFE |
-25.19 |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|