Basic Information


ANNInter ID ANNInter74440
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr004550 URS00023931A8_3702
Category tsRNA lncRNA
Coordinate 1:11166982-11261928(+)
Interaction Sequence GCGGAAAUAGCUUAAUGGUAGAGCA AAGGUGGCUAUUGAGUUGUUUCCAU
Interaction Site 1 - 25 62847 - 62871

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network