Basic Information


ANNInter ID ANNInter73435
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr004293 URS000238C7B5_3702
Category tsRNA lncRNA
Coordinate 3:10548803-10567233(+)
Interaction Sequence GCCCCCAUCGUCUAGUGGUUCA AGGGAUGCUAGACGAUGGGAGC
Interaction Site 1 - 22 12568 - 12589

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network