Basic Information


ANNInter ID ANNInter72812
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr004134 ath_circ_047317
Category tsRNA circRNA
Coordinate Pt:739-131051(.)
Interaction Sequence GAUUGGUCGUAGGUUCGAAU AUUCGAACCUACGACCAAUC
Interaction Site 1 - 20 108288 - 108307

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network