Basic Information


ANNInter ID ANNInter72773
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr004130 URS0002390009_3702
Category tsRNA lncRNA
Coordinate 4:11822891-11852312(+)
Interaction Sequence GAUUCUCGGAACACCCCCCA UGGGAAAUGUUCCGUGAAUU
Interaction Site 1 - 20 25817 - 25836

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network