Basic Information


ANNInter ID ANNInter72370
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr004085 URS0002381FDF_3702
Category tsRNA lncRNA
Coordinate 2:3437319-3534278(+)
Interaction Sequence GAUGUAGCUCAAAUGGUAGA CCCACCGUUAGAGCUGCAUA
Interaction Site 1 - 20 81115 - 81134

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network