Basic Information


ANNInter ID ANNInter72187
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr004062 URS0002421AB3_3702
Category tsRNA lncRNA
Coordinate 1:9889658-9912658(+)
Interaction Sequence GAUCCCCAGUGAAGUCGCCA UGGUGGCUUGACUGGGGGUU
Interaction Site 1 - 20 698 - 717

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network