Basic Information
| ANNInter ID |
ANNInter71715 |
| Interaction Type |
tsRNA - circRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath_tsr003931 |
ath_circ_047946 |
| Category |
tsRNA |
circRNA |
| Coordinate |
|
Pt:1717-136972(.) |
| Interaction Sequence |
GAGCCCCGCCGGGACCACCA |
AUCCGGUCCCGGCGGGGAUC |
| Interaction Site |
1 - 20 |
14386 - 14405 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|