Basic Information


ANNInter ID ANNInter71192
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr003803 URS000241AB84_3702
Category tsRNA lncRNA
Coordinate 2:3497441-3595523(+)
Interaction Sequence GACACUAGACUCUGAAUCUAGU UUAAGAUUUAGGGUUUAGGGUU
Interaction Site 1 - 22 32049 - 32070

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network