Basic Information
| ANNInter ID |
ANNInter70917 |
| Interaction Type |
tsRNA - lncRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath_tsr003723 |
URS0000A77405_3702 |
| Category |
tsRNA |
lncRNA |
| Coordinate |
|
1:2736598-2736830(-) |
| Interaction Sequence |
GAACCCGGGCGAAGCCACCA |
UGGUGGCUUUUUCUGGGUUU |
| Interaction Site |
1 - 20 |
26 - 45 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Translation |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|