Basic Information


ANNInter ID ANNInter70474
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr003585 URS0002353A5A_3702
Category tsRNA lncRNA
Coordinate 4:11872630-11935520(+)
Interaction Sequence CUGGUCAGGAUACUCGGCUCU AUAGUUGAGAAUCCUGCCCAG
Interaction Site 1 - 21 29764 - 29784

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network