Basic Information


ANNInter ID ANNInter70385
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr003566 URS00023771A1_3702
Category tsRNA lncRNA
Coordinate 3:11509097-11586604(+)
Interaction Sequence CUGCCACGGUACAGACCCGG UCGGGUCUACGUCGUGGCGG
Interaction Site 1 - 20 34606 - 34625

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network