Basic Information


ANNInter ID ANNInter69606
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr003387 URS000237E6D3_3702
Category tsRNA lncRNA
Coordinate 1:7453734-7530251(+)
Interaction Sequence CUAGUGGUAUGAUUCUCGCUU AAGCGAGAGUCAUGUCAUUAG
Interaction Site 1 - 21 56022 - 56042

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network