Basic Information
| ANNInter ID | ANNInter69195 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr003296 | URS000235C601_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 1:28122320-28159217(+) | |
| Interaction Sequence | CUAAUGGUCGCAGGUUCAAGUCCUG | AUCAGCAAGAACUUGUGACGGUUAG |
| Interaction Site | 1 - 25 | 1471 - 1495 |