Basic Information
| ANNInter ID | ANNInter68695 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr003109 | URS00023ADD34_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 2:4225748-4317670(+) | |
| Interaction Sequence | CGGUUCAAAUCCGA--UAAGGGGCUC | CAACUUUUUACGUCUGAUUUGAACCG |
| Interaction Site | 1 - 24 | 52522 - 52547 |