Basic Information


ANNInter ID ANNInter67976
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr002904 URS00023E9DDB_3702
Category tsRNA lncRNA
Coordinate 3:22745096-22746902(+)
Interaction Sequence CGCAUCUGUUUUGGGUACAG CUGUGUCCAGGCCAGAUGCG
Interaction Site 1 - 20 1068 - 1087

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network