Basic Information


ANNInter ID ANNInter67972
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr002901 URS00023D42DE_3702
Category tsRNA lncRNA
Coordinate 5:21216958-21242991(+)
Interaction Sequence CGCAGUCUGGUCAGCGCAUC GAUGUGCUGACCGGAAUGCC
Interaction Site 1 - 20 632 - 651

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network