Basic Information


ANNInter ID ANNInter67576
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr002846 URS000238B055_3702
Category tsRNA lncRNA
Coordinate 2:7632320-7634059(+)
Interaction Sequence CGAUCCUGCGUGAGGGCACCA AGUGGCUCUCACUUAGGAUCG
Interaction Site 1 - 21 1508 - 1528

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network