Basic Information


ANNInter ID ANNInter67516
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr002843 URS0002396630_3702
Category tsRNA lncRNA
Coordinate 1:10300334-10375760(+)
Interaction Sequence CGAUCCUCACCGUAGGCUCCA AGGAGCUUCCGGUGAGGAUUU
Interaction Site 1 - 21 36150 - 36170

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network