Basic Information


ANNInter ID ANNInter67414
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr002830 ath_circ_002475
Category tsRNA circRNA
Coordinate 1:4863545-4870684(.)
Interaction Sequence CGAUCCCCACCGAGCGUGCCA UUGAACUCUUGAUGGGGAUCA
Interaction Site 1 - 21 1066 - 1086

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network