Basic Information
| ANNInter ID | ANNInter67409 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr002829 | URS0000A76936_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 4:7221449-7221655(+) | |
| Interaction Sequence | CGAUCCCCACAGACGGCGCCA | UGGUGUUUUGAGGUGUCUGUGGGGGUUG |
| Interaction Site | 1 - 21 | 26 - 53 |