Basic Information
| ANNInter ID |
ANNInter67158 |
| Interaction Type |
tsRNA - circRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath_tsr002775 |
ath_circ_037001 |
| Category |
tsRNA |
circRNA |
| Coordinate |
|
5:2668390-2762594(.) |
| Interaction Sequence |
CGAGCCCCGCCGGAAGCACCA |
UGGUGGUUCUGGUGGGUUUUG |
| Interaction Site |
1 - 21 |
12861 - 12881 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|