Basic Information
| ANNInter ID | ANNInter67069 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | psRNATarget;RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr002756 | URS00023AB54C_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 2:6938648-6995767(+) | |
| Interaction Sequence | CGACCUUAGCUCAGUUGGUAGA | UCUACCAACUGAGCUAAGGUCG |
| Interaction Site | 1 - 22 | 8210 - 8231 |