Basic Information
| ANNInter ID |
ANNInter67017 |
| Interaction Type |
tsRNA - lncRNA |
| Identification Method(s) |
RNAhybrid;IntaRNA |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath_tsr002749 |
URS00001C33BA_3702 |
| Category |
tsRNA |
lncRNA |
| Coordinate |
|
2:13186544-13187253(-) |
| Interaction Sequence |
CGACCCCUUUCUCUAGCGCCA |
UGGUGGAGGAGGAGGGGGUUG |
| Interaction Site |
1 - 21 |
246 - 266 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
NA |
| RNAhybrid MFE |
-37.9 |
| IntaRNA MFE |
-25.97 |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|