Basic Information


ANNInter ID ANNInter66923
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr002738 URS00023817BB_3702
Category tsRNA lncRNA
Coordinate 4:7406518-7427502(+)
Interaction Sequence CGAAUCCUUCCGUCCCAGCC ACUUGGGACCGAAGGAGUUG
Interaction Site 1 - 20 3694 - 3713

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network