Basic Information


ANNInter ID ANNInter65214
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr002124 ath_circ_049608
Category tsRNA circRNA
Coordinate Pt:55364-153560(.)
Interaction Sequence CAUAAUGGAAAUGUAUCGGACU GGUUAUAUACAUUCUCAUUAUG
Interaction Site 1 - 22 88523 - 88544

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network