Basic Information
| ANNInter ID | ANNInter64524 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001948 | URS0002381FDF_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 2:3437319-3534278(+) | |
| Interaction Sequence | CACUCUGGACUUUGAAUCCAGCGAC | GUCUAUGG-UUUAAAGUUUAGGGUU |
| Interaction Site | 1 - 25 | 92566 - 92589 |