Basic Information
| ANNInter ID | ANNInter64272 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001895 | URS0002366DD8_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 1:9041978-9042750(+) | |
| Interaction Sequence | CACCAUCGCGGGUUCAAUUCCCGUCGUUCGCCCC | GGAGGCGAAGGCGGGGAUACAACUGACGAUGGUG |
| Interaction Site | 1 - 34 | 4 - 37 |