Basic Information
| ANNInter ID | ANNInter64227 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001878 | ath_circ_031298 |
| Category | tsRNA | circRNA |
| Coordinate | 4:9483314-9539381(.) | |
| Interaction Sequence | CACCAGUGGUCUAGUGGUAG-AAUA | UAUUAUUAUUAUUAGGUCAUUGGUG |
| Interaction Site | 1 - 24 | 15046 - 15070 |