Basic Information
| ANNInter ID | ANNInter62426 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001507 | URS000240B73D_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 2:16982369-16983327(+) | |
| Interaction Sequence | AUCCUUUUUCCCCAGUUCAAAUCCGGGUGCCGCCUCCA | UGGAGGCUGGAAUCAAAGGAAGCAUCGGAUUUGAGGGGGGGGGGGGGGGU |
| Interaction Site | 1 - 38 | 356 - 405 |