Basic Information
| ANNInter ID | ANNInter62408 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001507 | URS0000A76A75_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 4:10989908-10992242(-) | |
| Interaction Sequence | UCCUUUUUCCCCAGUUCAAAUCCGGGUGCCGCCUCC | GGAGGUGGUGGUUAAUGAGUAAGAAGGGAGGAAGGAGGA |
| Interaction Site | 2 - 37 | 1914 - 1952 |