Basic Information
| ANNInter ID | ANNInter62166 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001423 | ath_circ_024251 |
| Category | tsRNA | circRNA |
| Coordinate | 3:10822825-10993675(.) | |
| Interaction Sequence | AUCAGAGUGGCGCAGCGGAAGCGUG | UAUGCUUUAGCUGCGCCACUCUGAU |
| Interaction Site | 1 - 25 | 21875 - 21899 |