Basic Information


ANNInter ID ANNInter61331
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr001293 URS00023AB54C_3702
Category tsRNA lncRNA
Coordinate 2:6938648-6995767(+)
Interaction Sequence AGUUCAAAUCUGGUUCUUGGCACC GCUCCAGAGGACCAGAUUCGAGCG
Interaction Site 1 - 24 36021 - 36044

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network