Basic Information


ANNInter ID ANNInter61286
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr001290 URS00023B9DE2_3702
Category tsRNA lncRNA
Coordinate 2:17709308-17791283(+)
Interaction Sequence AGUUCAAAUCUGGUUCUUGGC CUCAAGGACCAUGUUUGGAUG
Interaction Site 1 - 21 63541 - 63561

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network