Basic Information
| ANNInter ID | ANNInter61255 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001288 | URS0000A765FD_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 3:11586005-11586548(-) | |
| Interaction Sequence | AGUUCAAAUCUCGGUAGGACCUCCA | UGGUGCUUUCAUUGAGAGUUGAACU |
| Interaction Site | 1 - 25 | 333 - 357 |