Basic Information
| ANNInter ID | ANNInter61228 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | RNAhybrid;IntaRNA |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001282 | URS0000A7764B_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | 2:7821596-7822100(-) | |
| Interaction Sequence | AGUGGUUCAGGACAUCUCUCUUUCAAGGAGGCAGCGGGGA | UUCCCGCUUUGUCCUCCUCCUUCUCCUGAACCCU |
| Interaction Site | 1 - 40 | 230 - 263 |