Basic Information
| ANNInter ID | ANNInter60759 |
|---|---|
| Interaction Type | tsRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001201 | URS00023E0CDE_3702 |
| Category | tsRNA | lncRNA |
| Coordinate | Mt:334098-365291(+) | |
| Interaction Sequence | AGUGGAUUGUGAAUUCACCAU-CGC | GCGCAUGGUGGAUUCACAAUCCACU |
| Interaction Site | 1 - 24 | 25592 - 25616 |