Basic Information
| ANNInter ID |
ANNInter60649 |
| Interaction Type |
tsRNA - lncRNA |
| Identification Method(s) |
RNAhybrid;IntaRNA |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath_tsr001191 |
URS0002386ED5_3702 |
| Category |
tsRNA |
lncRNA |
| Coordinate |
|
4:15231590-15272174(+) |
| Interaction Sequence |
AGUGGAUUAAGGCAGUGGAUUG |
CAAUCCACUGCAAUAGUUUACU |
| Interaction Site |
1 - 22 |
1544 - 1565 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
NA |
| RNAhybrid MFE |
-31.9 |
| IntaRNA MFE |
-25.38 |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|