Basic Information
| ANNInter ID | ANNInter60492 |
|---|---|
| Interaction Type | tsRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath_tsr001157 | ath_circ_024425 |
| Category | tsRNA | circRNA |
| Coordinate | 3:13864282-14193011(.) | |
| Interaction Sequence | AGUACCCUGCCACGGU---ACAGAC | GUUUGUUGAAUCUUGGCAGGGUACU |
| Interaction Site | 1 - 22 | 284907 - 284931 |