Basic Information


ANNInter ID ANNInter60328
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr001110 URS000238734E_3702
Category tsRNA lncRNA
Coordinate 5:13092132-13093362(+)
Interaction Sequence AGGUCCGUAGUUCGAUCCUG AUGGAUCCAAUUAUGGACGU
Interaction Site 1 - 20 284 - 303

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network