Basic Information


ANNInter ID ANNInter60025
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr001042 URS0002381B19_3702
Category tsRNA lncRNA
Coordinate 4:9491385-9550153(+)
Interaction Sequence AGGCGCUUGACUUCUAAUCAAGCGA CCUUAAAAUUAGAAGGCAAACGCUU
Interaction Site 1 - 25 57516 - 57540

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network