Basic Information


ANNInter ID ANNInter59761
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr000995 URS00023B7AB0_3702
Category tsRNA lncRNA
Coordinate 3:16957940-16961110(+)
Interaction Sequence AGGAUACUCGGCUCUCACCC UUCUGAGAGCUGAGUAGUCU
Interaction Site 1 - 20 2266 - 2285

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network