Basic Information


ANNInter ID ANNInter59751
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr000994 URS00023AD11A_3702
Category tsRNA lncRNA
Coordinate 3:13593561-13682414(+)
Interaction Sequence AGGAUACUCGG-CUCUCACC GGAGAGAGGUCGAGUAUCCU
Interaction Site 1 - 19 12306 - 12325

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Translation
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network