Basic Information


ANNInter ID ANNInter59577
Interaction Type tsRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr000949 ath_circ_046813
Category tsRNA circRNA
Coordinate Pt:425-137153(.)
Interaction Sequence AGGACAUCUCUCUUUCAAGGAGGC GCCUCCUUGAAAGAGAGAUGUCCU
Interaction Site 1 - 24 30070 - 30093

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network