Basic Information


ANNInter ID ANNInter58734
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr000763 URS0002376853_3702
Category tsRNA lncRNA
Coordinate 1:7453566-7546337(+)
Interaction Sequence AGCACUCAGGACUUUGAAUC UAUUAAAAGUUCAGAGAGUU
Interaction Site 1 - 20 86374 - 86393

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network