Basic Information


ANNInter ID ANNInter58674
Interaction Type tsRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath_tsr000731 URS0000A776EE_3702
Category tsRNA lncRNA
Coordinate 5:18421549-18431063(+)
Interaction Sequence AGAGGUUAGAGCAUC--GCAU AUGCUGGAUGCUCUAACUUCU
Interaction Site 1 - 19 2541 - 2561

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network